From: Andreas Tille Date: Tue, 11 Feb 2014 17:46:38 +0000 (+0100) Subject: Imported Upstream version 0.7.5 X-Git-Tag: archive/raspbian/0.22.0+ds-1+rpi1~1^2^2~379^2~3 X-Git-Url: https://dgit.raspbian.org/%22http://www.example.com/cgi/success/%22http:/www.example.com/cgi/success?a=commitdiff_plain;h=3932a10bd953d5eff2578e9d64d8a6a76182ea02;p=python-pysam.git Imported Upstream version 0.7.5 --- diff --git a/debian/changelog b/debian/changelog deleted file mode 100644 index f42b387..0000000 --- a/debian/changelog +++ /dev/null @@ -1,37 +0,0 @@ -pysam (0.7.5-1) UNRELEASED; urgency=low - - * New upstream release. - - -- Andreas Tille Fri, 07 Feb 2014 18:29:40 +0100 - -pysam (0.7-1) UNRELEASED; urgency=low - - * New upstream release. - - -- Dominique Belhachemi Mon, 03 Dec 2012 16:29:09 -0500 - -pysam (0.6-1) UNRELEASED; urgency=low - - * New upstream release. - - -- Dominique Belhachemi Fri, 16 Dec 2011 16:22:30 -0500 - -pysam (0.5-1) UNRELEASED; urgency=low - - * New upstream release. - - -- Charles Plessy Wed, 08 Jun 2011 19:43:52 +0900 - -pysam (0.4.1-1) UNRELEASED; urgency=low - - * New upstream release. - * Issue 54 fixed upstream; removed patch system. - * Build-depend on python-setuptools. - - -- Charles Plessy Mon, 14 Feb 2011 18:54:36 +0900 - -pysam (0.3.1-1) UNRELEASED; urgency=low - - * Draft package - - -- Charles Plessy Thu, 13 Jan 2011 19:32:07 +0900 diff --git a/debian/compat b/debian/compat deleted file mode 100644 index ec63514..0000000 --- a/debian/compat +++ /dev/null @@ -1 +0,0 @@ -9 diff --git a/debian/control b/debian/control deleted file mode 100644 index c6143b6..0000000 --- a/debian/control +++ /dev/null @@ -1,45 +0,0 @@ -Source: pysam -Maintainer: Debian Med Packaging Team -Uploaders: Charles Plessy , - Andreas Tille -Section: python -XS-Testsuite: autopkgtest -Priority: optional -Build-Depends: debhelper (>= 9), - python-all-dev, - python-setuptools, - cython, - zlib1g-dev, - samtools -Standards-Version: 3.9.5 -Vcs-Browser: http://anonscm.debian.org/gitweb/?p=debian-med/pysam.git -Vcs-Git: git://anonscm.debian.org/debian-med/pysam.git -Homepage: http://code.google.com/p/pysam/ -X-Python-Version: >= 2.6 - -Package: python-pysam -Architecture: any -Depends: ${shlibs:Depends}, - ${misc:Depends}, - ${python:Depends}, - python-pyrex -Description: interface for the SAM/BAM sequence alignment and mapping format - Pysam is a Python module for reading and manipulating Samfiles. It's a - lightweight wrapper of the samtools C-API. - -Package: python-pysam-tests -Architecture: all -Priority: extra -Enhances: python-pysam -Depends: ${shlibs:Depends}, - ${misc:Depends}, - ${python:Depends}, - python, - python-pysam, - python-pyrex -Description: interface for the SAM/BAM sequence alignment and mapping format (test data) - Pysam is a Python module for reading and manipulating Samfiles. It's a - lightweight wrapper of the samtools C-API. - . - This package contains the data provided by upstream to run the pysam - test suite. diff --git a/debian/copyright b/debian/copyright deleted file mode 100644 index 85b2e3d..0000000 --- a/debian/copyright +++ /dev/null @@ -1,107 +0,0 @@ -Format: http://www.debian.org/doc/packaging-manuals/copyright-format/1.0/ -Upstream-Name: pysam -Upstream-Contact: Heng Li -Source: http://pysam.googlecode.com/files/pysam-0.7.tar.gz - -Files: * -Copyright: 2008-2010 Genome Research Ltd. -License: MIT - -Files: samtools/khash.h samtools/kseq.h -Copyright: 2008-2011 by Attractive Chaos -License: MIT - -Files: samtools/kprobaln.c.pysam.c -Copyright: 2003-2006, 2008-2010, by Heng Li -License: MIT - -Files: tabix/tabix.h -Copyright: 2009 Genome Research Ltd (GRL), 2010 Broad Institute -License: MIT - -Files: samtools/bcftools/bcf.h -Copyright: 2010 Broad Institute -License: MIT - -Files: samtools/bgzf.c.pysam.c samtools/bgzf.h tabix/bgzf.c.pysam.c tabix/bgzf.h samtools/knetfile.c.pysam.c -Copyright: 2008 Broad Institute / Massachusetts Institute of Technology - 2010-2012 Attractive Chaos -License: MIT - -Files: tabix/bgzip.c.pysam.c -Copyright: 2008 Broad Institute / Massachusetts Institute of Technology -License: MIT - -Files: samtools/kaln.c.pysam.c samtools/kaln.h samtools/kprobaln.h -Copyright: 2003-2006, 2008, 2009, by Heng Li -License: MIT - -Files: samtools/razf.c.pysam.c samtools/razf.h -Copyright: 2008 Jue Ruan , Heng Li -License: BSDlike1 - Redistribution and use in source and binary forms, with or without - modification, are permitted provided that the following conditions - are met: - 1. Redistributions of source code must retain the above copyright - notice, this list of conditions and the following disclaimer. - 2. Redistributions in binary form must reproduce the above copyright - notice, this list of conditions and the following disclaimer in the - documentation and/or other materials provided with the distribution. - . - THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND - ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE - IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE - ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE - FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL - DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS - OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) - HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT - LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY - OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF - SUCH DAMAGE. - -Files: samtools/win32/zconf.h samtools/win32/zlib.h -Copyright: 1995-2005 Jean-loup Gailly and Mark Adler -License: BSDlike2 - This software is provided 'as-is', without any express or implied - warranty. In no event will the authors be held liable for any damages - arising from the use of this software. - . - Permission is granted to anyone to use this software for any purpose, - including commercial applications, and to alter it and redistribute it - freely, subject to the following restrictions: - . - 1. The origin of this software must not be misrepresented; you must not - claim that you wrote the original software. If you use this software - in a product, an acknowledgment in the product documentation would be - appreciated but is not required. - 2. Altered source versions must be plainly marked as such, and must not be - misrepresented as being the original software. - 3. This notice may not be removed or altered from any source distribution. -Comment: These files are not used and could be stripped from the source - -Files: samtools/win32/xcurses.h -Copyright: 2008 wmcbrine -License: PublicDomain - This file is in public domain. -Comment: These files are not used and could be stripped from the source - -License: MIT - Permission is hereby granted, free of charge, to any person obtaining a copy - of this software and associated documentation files (the "Software"), to deal - in the Software without restriction, including without limitation the rights - to use, copy, modify, merge, publish, distribute, sublicense, and/or sell - copies of the Software, and to permit persons to whom the Software is - furnished to do so, subject to the following conditions: - . - The above copyright notice and this permission notice shall be included in - all copies or substantial portions of the Software. - . - THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR - IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, - FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE - AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER - LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, - OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN - THE SOFTWARE. - diff --git a/debian/patches/do_not_use_distribute_setup.patch b/debian/patches/do_not_use_distribute_setup.patch deleted file mode 100644 index fd60f92..0000000 --- a/debian/patches/do_not_use_distribute_setup.patch +++ /dev/null @@ -1,17 +0,0 @@ -Author: Olivier Sallou -Last-Updated: Fri, 07 Feb 2014 18:29:40 +0100 -Description: Prevent downloading distribute_setup - ---- pysam.orig/setup.py -+++ pysam/setup.py -@@ -127,8 +127,8 @@ - # cp samtools/win32/*.h pysam/include/win32 - - --from distribute_setup import use_setuptools --use_setuptools() -+#from distribute_setup import use_setuptools -+#use_setuptools() - - from setuptools import Extension, setup, find_packages - diff --git a/debian/patches/fix_cleanup_tests.patch b/debian/patches/fix_cleanup_tests.patch deleted file mode 100644 index 178876e..0000000 --- a/debian/patches/fix_cleanup_tests.patch +++ /dev/null @@ -1,19 +0,0 @@ -Author: Andreas Tille -Last-Changed: Mon, 10 Feb 2014 11:29:40 +0100 -Description: Prevent tests makefile from deleting files which - are contained inside the upstream source - ---- a/tests/Makefile -+++ b/tests/Makefile -@@ -47,6 +47,11 @@ example_bai.bam: ex1.bam - - - clean: -+ mkdir keep_bam_files -+ mv ex9_fail.bam ex9_nofail.bam example_btag.bam example_empty_header.bam issue100.bam tag_bug.bam test_unaligned.bam keep_bam_files - rm -fr *.bam *.bai *.fai *.pileup* \ - *~ calDepth *.dSYM pysam_*.sam \ - ex2.sam ex2.sam.gz ex1.sam -+ mv keep_bam_files/* . -+ rmdir keep_bam_files -+ rm -rf pysam_test_work/ diff --git a/debian/patches/offline-tests.patch b/debian/patches/offline-tests.patch deleted file mode 100644 index 968b5ba..0000000 --- a/debian/patches/offline-tests.patch +++ /dev/null @@ -1,1824 +0,0 @@ -Author: Andreas Tille -Last-Changed: Mon, 10 Feb 2014 11:29:40 +0100 -Description: Create a copy of the test suite script and remove those - tests that try to fetch files from network - ---- /dev/null -+++ b/tests/pysam_test_offline.py -@@ -0,0 +1,1816 @@ -+#!/usr/bin/env python -+'''unit testing code for pysam. -+ -+Execute in the :file:`tests` directory as it requires the Makefile -+and data files located there. -+''' -+ -+import pysam -+import unittest -+import os, re, sys -+import itertools -+import collections -+import subprocess -+import shutil -+import logging -+ -+IS_PYTHON3 = sys.version_info[0] >= 3 -+ -+if IS_PYTHON3: -+ from itertools import zip_longest -+else: -+ from itertools import izip as zip_longest -+ -+ -+SAMTOOLS="samtools" -+WORKDIR="pysam_test_work" -+ -+def checkBinaryEqual( filename1, filename2 ): -+ '''return true if the two files are binary equal.''' -+ if os.path.getsize( filename1 ) != os.path.getsize( filename2 ): -+ return False -+ -+ infile1 = open(filename1, "rb") -+ infile2 = open(filename2, "rb") -+ -+ def chariter( infile ): -+ while 1: -+ c = infile.read(1) -+ if c == b"": break -+ yield c -+ -+ found = False -+ for c1,c2 in zip_longest( chariter( infile1), chariter( infile2) ): -+ if c1 != c2: break -+ else: -+ found = True -+ -+ infile1.close() -+ infile2.close() -+ return found -+ -+def runSamtools( cmd ): -+ '''run a samtools command''' -+ -+ try: -+ retcode = subprocess.call(cmd, shell=True, -+ stderr = subprocess.PIPE) -+ if retcode < 0: -+ print("Child was terminated by signal", -retcode) -+ except OSError as e: -+ print("Execution failed:", e) -+ -+def getSamtoolsVersion(): -+ '''return samtools version''' -+ -+ with subprocess.Popen(SAMTOOLS, shell=True, stderr=subprocess.PIPE).stderr as pipe: -+ lines = b"".join(pipe.readlines()) -+ -+ if IS_PYTHON3: -+ lines = lines.decode('ascii') -+ return re.search( "Version:\s+(\S+)", lines).groups()[0] -+ -+class BinaryTest(unittest.TestCase): -+ '''test samtools command line commands and compare -+ against pysam commands. -+ -+ Tests fail, if the output is not binary identical. -+ ''' -+ -+ first_time = True -+ -+ # a dictionary of commands to test -+ # first entry: (samtools output file, samtools command) -+ # second entry: (pysam output file, (pysam function, pysam options) ) -+ commands = \ -+ { -+ "view" : -+ ( -+ ("ex1.view", "view ex1.bam > ex1.view"), -+ ("pysam_ex1.view", (pysam.view, "ex1.bam" ) ), -+ ), -+ "view2" : -+ ( -+ ("ex1.view", "view -bT ex1.fa -o ex1.view2 ex1.sam"), -+ # note that -o ex1.view2 throws exception. -+ ("pysam_ex1.view", (pysam.view, "-bT ex1.fa -oex1.view2 ex1.sam" ) ), -+ ), -+ "sort" : -+ ( -+ ( "ex1.sort.bam", "sort ex1.bam ex1.sort" ), -+ ( "pysam_ex1.sort.bam", (pysam.sort, "ex1.bam pysam_ex1.sort" ) ), -+ ), -+ "mpileup" : -+ ( -+ ("ex1.pileup", "mpileup ex1.bam > ex1.pileup" ), -+ ("pysam_ex1.mpileup", (pysam.mpileup, "ex1.bam" ) ), -+ ), -+ "depth" : -+ ( -+ ("ex1.depth", "depth ex1.bam > ex1.depth" ), -+ ("pysam_ex1.depth", (pysam.depth, "ex1.bam" ) ), -+ ), -+ "faidx" : -+ ( -+ ("ex1.fa.fai", "faidx ex1.fa"), -+ ("pysam_ex1.fa.fai", (pysam.faidx, "ex1.fa") ), -+ ), -+ "index": -+ ( -+ ("ex1.bam.bai", "index ex1.bam" ), -+ ("pysam_ex1.bam.bai", (pysam.index, "pysam_ex1.bam" ) ), -+ ), -+ "idxstats" : -+ ( -+ ("ex1.idxstats", "idxstats ex1.bam > ex1.idxstats" ), -+ ("pysam_ex1.idxstats", (pysam.idxstats, "pysam_ex1.bam" ) ), -+ ), -+ "fixmate" : -+ ( -+ ("ex1.fixmate", "fixmate ex1.bam ex1.fixmate" ), -+ ("pysam_ex1.fixmate", (pysam.fixmate, "pysam_ex1.bam pysam_ex1.fixmate") ), -+ ), -+ "flagstat" : -+ ( -+ ("ex1.flagstat", "flagstat ex1.bam > ex1.flagstat" ), -+ ("pysam_ex1.flagstat", (pysam.flagstat, "pysam_ex1.bam") ), -+ ), -+ "calmd" : -+ ( -+ ("ex1.calmd", "calmd ex1.bam ex1.fa > ex1.calmd" ), -+ ("pysam_ex1.calmd", (pysam.calmd, "pysam_ex1.bam ex1.fa") ), -+ ), -+ "merge" : -+ ( -+ ("ex1.merge", "merge -f ex1.merge ex1.bam ex1.bam" ), -+ # -f option does not work - following command will cause the subsequent -+ # command to fail -+ ("pysam_ex1.merge", (pysam.merge, "pysam_ex1.merge pysam_ex1.bam pysam_ex1.bam") ), -+ ), -+ "rmdup" : -+ ( -+ ("ex1.rmdup", "rmdup ex1.bam ex1.rmdup" ), -+ ("pysam_ex1.rmdup", (pysam.rmdup, "pysam_ex1.bam pysam_ex1.rmdup" )), -+ ), -+ "reheader" : -+ ( -+ ( "ex1.reheader", "reheader ex1.bam ex1.bam > ex1.reheader"), -+ ( "pysam_ex1.reheader", (pysam.reheader, "ex1.bam ex1.bam" ) ), -+ ), -+ "cat": -+ ( -+ ( "ex1.cat", "cat ex1.bam ex1.bam > ex1.cat"), -+ ( "pysam_ex1.cat", (pysam.cat, "ex1.bam ex1.bam" ) ), -+ ), -+ "targetcut": -+ ( -+ ("ex1.targetcut", "targetcut ex1.bam > ex1.targetcut" ), -+ ("pysam_ex1.targetcut", (pysam.targetcut, "pysam_ex1.bam") ), -+ ), -+ "phase": -+ ( -+ ("ex1.phase", "phase ex1.bam > ex1.phase" ), -+ ("pysam_ex1.phase", (pysam.phase, "pysam_ex1.bam") ), -+ ), -+ "import" : -+ ( -+ ("ex1.bam", "import ex1.fa.fai ex1.sam.gz ex1.bam" ), -+ ("pysam_ex1.bam", (pysam.samimport, "ex1.fa.fai ex1.sam.gz pysam_ex1.bam") ), -+ ), -+ "bam2fq": -+ ( -+ ("ex1.bam2fq", "bam2fq ex1.bam > ex1.bam2fq" ), -+ ("pysam_ex1.bam2fq", (pysam.bam2fq, "pysam_ex1.bam") ), -+ ), -+ "pad2unpad": -+ ( -+ ("ex2.unpad", "pad2unpad -T ex1.fa ex2.bam > ex2.unpad" ), -+ ("pysam_ex2.unpad", (pysam.pad2unpad, "-T ex1.fa ex2.bam") ), -+ ), -+ "bamshuf": -+ ( -+ ("ex1.bamshuf.bam", "bamshuf ex1.bam ex1.bamshuf" ), -+ ("pysam_ex1.bamshuf.bam", (pysam.bamshuf, "ex1.bam pysam_ex1.bamshuf") ), -+ ), -+ "bedcov": -+ ( -+ ("ex1.bedcov", "bedcov ex1.bed ex1.bam > ex1.bedcov" ), -+ ("pysam_ex1.bedcov", (pysam.bedcov, "ex1.bed ex1.bam") ), -+ ), -+ } -+ -+ # some tests depend on others. The order specifies in which order -+ # the samtools commands are executed. -+ # The first three (faidx, import, index) need to be in that order, -+ # the rest is arbitrary. -+ order = ('faidx', 'import', 'index', -+ # 'pileup1', 'pileup2', deprecated -+ # 'glfview', deprecated -+ 'view', 'view2', -+ 'sort', -+ 'mpileup', -+ 'depth', -+ 'idxstats', -+ 'fixmate', -+ 'flagstat', -+ ## 'calmd', -+ 'merge', -+ 'rmdup', -+ 'reheader', -+ 'cat', -+ 'bedcov', -+ 'targetcut', -+ 'phase', -+ 'bamshuf', -+ 'bam2fq', -+ 'pad2unpad', -+ ) -+ -+ def setUp( self ): -+ '''setup tests. -+ -+ For setup, all commands will be run before the first test is -+ executed. Individual tests will then just compare the output -+ files. -+ ''' -+ if BinaryTest.first_time: -+ -+ # remove previous files -+ if os.path.exists( WORKDIR ): -+ shutil.rmtree( WORKDIR ) -+ pass -+ -+ # copy the source files to WORKDIR -+ os.makedirs( WORKDIR ) -+ -+ shutil.copy( "ex1.fa", os.path.join( WORKDIR, "pysam_ex1.fa" ) ) -+ shutil.copy( "ex1.fa", os.path.join( WORKDIR, "ex1.fa" ) ) -+ shutil.copy( "ex1.sam.gz", os.path.join( WORKDIR, "ex1.sam.gz" ) ) -+ shutil.copy( "ex1.sam", os.path.join( WORKDIR, "ex1.sam" ) ) -+ shutil.copy( "ex2.bam", os.path.join( WORKDIR, "ex2.bam" ) ) -+ -+ # cd to workdir -+ savedir = os.getcwd() -+ os.chdir( WORKDIR ) -+ -+ for label in self.order: -+ # print ("command=", label) -+ command = self.commands[label] -+ # build samtools command and target and run -+ samtools_target, samtools_command = command[0] -+ runSamtools( " ".join( (SAMTOOLS, samtools_command ))) -+ -+ # get pysam command and run -+ try: -+ pysam_target, pysam_command = command[1] -+ except ValueError as msg: -+ raise ValueError( "error while setting up %s=%s: %s" %\ -+ (label, command, msg) ) -+ -+ pysam_method, pysam_options = pysam_command -+ try: -+ output = pysam_method( *pysam_options.split(" "), raw=True) -+ except pysam.SamtoolsError as msg: -+ raise pysam.SamtoolsError( "error while executing %s: options=%s: msg=%s" %\ -+ (label, pysam_options, msg) ) -+ -+ -+ if ">" in samtools_command: -+ with open( pysam_target, "wb" ) as outfile: -+ if type(output) == list: -+ if IS_PYTHON3: -+ for line in output: -+ outfile.write( line.encode('ascii') ) -+ else: -+ for line in output: outfile.write( line ) -+ else: -+ outfile.write(output) -+ -+ os.chdir( savedir ) -+ BinaryTest.first_time = False -+ -+ samtools_version = getSamtoolsVersion() -+ -+ -+ def _r( s ): -+ # patch - remove any of the alpha/beta suffixes, i.e., 0.1.12a -> 0.1.12 -+ if s.count('-') > 0: s = s[0:s.find('-')] -+ return re.sub( "[^0-9.]", "", s ) -+ -+ if _r(samtools_version) != _r( pysam.__samtools_version__): -+ raise ValueError("versions of pysam/samtools and samtools differ: %s != %s" % \ -+ (pysam.__samtools_version__, -+ samtools_version )) -+ -+ def checkCommand( self, command ): -+ if command: -+ samtools_target, pysam_target = self.commands[command][0][0], self.commands[command][1][0] -+ samtools_target = os.path.join( WORKDIR, samtools_target ) -+ pysam_target = os.path.join( WORKDIR, pysam_target ) -+ self.assertTrue( checkBinaryEqual( samtools_target, pysam_target ), -+ "%s failed: files %s and %s are not the same" % (command, samtools_target, pysam_target) ) -+ -+ def testImport( self ): -+ self.checkCommand( "import" ) -+ -+ def testIndex( self ): -+ self.checkCommand( "index" ) -+ -+ def testSort( self ): -+ self.checkCommand( "sort" ) -+ -+ def testMpileup( self ): -+ self.checkCommand( "mpileup" ) -+ -+ def testDepth( self ): -+ self.checkCommand( "depth" ) -+ -+ def testIdxstats( self ): -+ self.checkCommand( "idxstats" ) -+ -+ def testFixmate( self ): -+ self.checkCommand( "fixmate" ) -+ -+ def testFlagstat( self ): -+ self.checkCommand( "flagstat" ) -+ -+ def testMerge( self ): -+ self.checkCommand( "merge" ) -+ -+ def testRmdup( self ): -+ self.checkCommand( "rmdup" ) -+ -+ def testReheader( self ): -+ self.checkCommand( "reheader" ) -+ -+ def testCat( self ): -+ self.checkCommand( "cat" ) -+ -+ def testTargetcut( self ): -+ self.checkCommand( "targetcut" ) -+ -+ def testPhase( self ): -+ self.checkCommand( "phase" ) -+ -+ def testBam2fq( self ): -+ self.checkCommand( "bam2fq" ) -+ -+ def testBedcov( self ): -+ self.checkCommand( "bedcov" ) -+ -+ def testBamshuf( self ): -+ self.checkCommand( "bamshuf" ) -+ -+ def testPad2Unpad( self ): -+ self.checkCommand( "pad2unpad" ) -+ -+ # def testPileup1( self ): -+ # self.checkCommand( "pileup1" ) -+ -+ # def testPileup2( self ): -+ # self.checkCommand( "pileup2" ) -+ -+ # deprecated -+ # def testGLFView( self ): -+ # self.checkCommand( "glfview" ) -+ -+ def testView( self ): -+ self.checkCommand( "view" ) -+ -+ def testEmptyIndex( self ): -+ self.assertRaises( IOError, pysam.index, "exdoesntexist.bam" ) -+ -+ def __del__(self): -+ if os.path.exists( WORKDIR ): -+ pass -+ # shutil.rmtree( WORKDIR ) -+ -+class IOTest(unittest.TestCase): -+ '''check if reading samfile and writing a samfile are consistent.''' -+ -+ def checkEcho( self, input_filename, -+ reference_filename, -+ output_filename, -+ input_mode, output_mode, use_template = True ): -+ '''iterate through *input_filename* writing to *output_filename* and -+ comparing the output to *reference_filename*. -+ -+ The files are opened according to the *input_mode* and *output_mode*. -+ -+ If *use_template* is set, the header is copied from infile using the -+ template mechanism, otherwise target names and lengths are passed -+ explicitely. -+ -+ ''' -+ -+ infile = pysam.Samfile( input_filename, input_mode ) -+ if use_template: -+ outfile = pysam.Samfile( output_filename, output_mode, template = infile ) -+ else: -+ outfile = pysam.Samfile( output_filename, output_mode, -+ referencenames = infile.references, -+ referencelengths = infile.lengths, -+ add_sq_text = False ) -+ -+ iter = infile.fetch() -+ -+ for x in iter: outfile.write( x ) -+ infile.close() -+ outfile.close() -+ -+ self.assertTrue( checkBinaryEqual( reference_filename, output_filename), -+ "files %s and %s are not the same" % (reference_filename, output_filename) ) -+ -+ -+ def testReadWriteBam( self ): -+ -+ input_filename = "ex1.bam" -+ output_filename = "pysam_ex1.bam" -+ reference_filename = "ex1.bam" -+ -+ self.checkEcho( input_filename, reference_filename, output_filename, -+ "rb", "wb" ) -+ -+ def testReadWriteBamWithTargetNames( self ): -+ -+ input_filename = "ex1.bam" -+ output_filename = "pysam_ex1.bam" -+ reference_filename = "ex1.bam" -+ -+ self.checkEcho( input_filename, reference_filename, output_filename, -+ "rb", "wb", use_template = False ) -+ -+ def testReadWriteSamWithHeader( self ): -+ -+ input_filename = "ex2.sam" -+ output_filename = "pysam_ex2.sam" -+ reference_filename = "ex2.sam" -+ -+ self.checkEcho( input_filename, reference_filename, output_filename, -+ "r", "wh" ) -+ -+ def testReadWriteSamWithoutHeader( self ): -+ -+ input_filename = "ex2.sam" -+ output_filename = "pysam_ex2.sam" -+ reference_filename = "ex1.sam" -+ -+ self.checkEcho( input_filename, reference_filename, output_filename, -+ "r", "w" ) -+ -+ def testReadSamWithoutTargetNames( self ): -+ '''see issue 104.''' -+ input_filename = "example_unmapped_reads_no_sq.sam" -+ -+ # raise exception in default mode -+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" ) -+ -+ # raise exception if no SQ files -+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r", -+ check_header = True) -+ -+ infile = pysam.Samfile( input_filename, check_header = False, check_sq = False ) -+ result = list(infile.fetch()) -+ -+ def testReadBamWithoutTargetNames( self ): -+ '''see issue 104.''' -+ input_filename = "example_unmapped_reads_no_sq.bam" -+ -+ # raise exception in default mode -+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" ) -+ -+ # raise exception if no SQ files -+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r", -+ check_header = True) -+ -+ -+ infile = pysam.Samfile( input_filename, check_header = False, check_sq = False ) -+ result = list(infile.fetch( until_eof = True)) -+ -+ def testReadSamWithoutHeader( self ): -+ input_filename = "ex1.sam" -+ output_filename = "pysam_ex1.sam" -+ reference_filename = "ex1.sam" -+ -+ # reading from a samfile without header is not implemented. -+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" ) -+ -+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r", -+ check_header = False ) -+ -+ def testReadUnformattedFile( self ): -+ '''test reading from a file that is not bam/sam formatted''' -+ input_filename = "example.vcf40" -+ -+ # bam - file raise error -+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "rb" ) -+ -+ # sam - file error, but can't fetch -+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" ) -+ -+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r", -+ check_header = False) -+ -+ def testBAMWithoutAlignedReads( self ): -+ '''see issue 117''' -+ input_filename = "test_unaligned.bam" -+ samfile = pysam.Samfile( input_filename, "rb", check_sq = False ) -+ samfile.fetch( until_eof = True ) -+ -+ def testBAMWithShortBAI( self ): -+ '''see issue 116''' -+ input_filename = "example_bai.bam" -+ samfile = pysam.Samfile( input_filename, "rb", check_sq = False ) -+ samfile.fetch( 'chr2' ) -+ -+ def testFetchFromClosedFile( self ): -+ -+ samfile = pysam.Samfile( "ex1.bam", "rb" ) -+ samfile.close() -+ self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120) -+ -+ def testClosedFile( self ): -+ '''test that access to a closed samfile raises ValueError.''' -+ -+ samfile = pysam.Samfile( "ex1.bam", "rb" ) -+ samfile.close() -+ self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120) -+ self.assertRaises( ValueError, samfile.pileup, 'chr1', 100, 120) -+ self.assertRaises( ValueError, samfile.getrname, 0 ) -+ self.assertRaises( ValueError, samfile.tell ) -+ self.assertRaises( ValueError, samfile.seek, 0 ) -+ self.assertRaises( ValueError, getattr, samfile, "nreferences" ) -+ self.assertRaises( ValueError, getattr, samfile, "references" ) -+ self.assertRaises( ValueError, getattr, samfile, "lengths" ) -+ self.assertRaises( ValueError, getattr, samfile, "text" ) -+ self.assertRaises( ValueError, getattr, samfile, "header" ) -+ -+ # write on closed file -+ self.assertEqual( 0, samfile.write(None) ) -+ -+ def testAutoDetection( self ): -+ '''test if autodetection works.''' -+ -+ samfile = pysam.Samfile( "ex3.sam" ) -+ self.assertRaises( ValueError, samfile.fetch, 'chr1' ) -+ samfile.close() -+ -+ samfile = pysam.Samfile( "ex3.bam" ) -+ samfile.fetch('chr1') -+ samfile.close() -+ -+ def testReadingFromSamFileWithoutHeader( self ): -+ '''read from samfile without header. -+ ''' -+ samfile = pysam.Samfile( "ex7.sam", check_header = False, check_sq = False ) -+ self.assertRaises( NotImplementedError, samfile.__iter__ ) -+ -+ def testReadingFromFileWithoutIndex( self ): -+ '''read from bam file without index.''' -+ -+ assert not os.path.exists( "ex2.bam.bai" ) -+ samfile = pysam.Samfile( "ex2.bam", "rb" ) -+ self.assertRaises( ValueError, samfile.fetch ) -+ self.assertEqual( len(list( samfile.fetch(until_eof = True) )), 3270 ) -+ -+ def testReadingUniversalFileMode( self ): -+ '''read from samfile without header. -+ ''' -+ -+ input_filename = "ex2.sam" -+ output_filename = "pysam_ex2.sam" -+ reference_filename = "ex1.sam" -+ -+ self.checkEcho( input_filename, reference_filename, output_filename, -+ "rU", "w" ) -+ -+class TestFloatTagBug( unittest.TestCase ): -+ '''see issue 71''' -+ -+ def testFloatTagBug( self ): -+ '''a float tag before another exposed a parsing bug in bam_aux_get. -+ -+ Fixed in 0.1.19 -+ ''' -+ samfile = pysam.Samfile("tag_bug.bam") -+ read = next(samfile.fetch(until_eof=True)) -+ self.assertTrue( ('XC',1) in read.tags ) -+ self.assertEqual(read.opt('XC'), 1) -+ -+class TestLargeFieldBug( unittest.TestCase ): -+ '''see issue 100''' -+ -+ def testLargeFileBug( self ): -+ '''when creating a read with a large entry in the tag field -+ causes an errror: -+ NotImplementedError: tags field too large -+ ''' -+ samfile = pysam.Samfile("issue100.bam") -+ read = next(samfile.fetch(until_eof=True)) -+ new_read = pysam.AlignedRead() -+ new_read.tags = read.tags -+ self.assertEqual( new_read.tags, read.tags ) -+ -+class TestTagParsing( unittest.TestCase ): -+ '''tests checking the accuracy of tag setting and retrieval.''' -+ -+ def makeRead( self ): -+ a = pysam.AlignedRead() -+ a.qname = "read_12345" -+ a.tid = 0 -+ a.seq="ACGT" * 3 -+ a.flag = 0 -+ a.rname = 0 -+ a.pos = 1 -+ a.mapq = 20 -+ a.cigar = ( (0,10), (2,1), (0,25) ) -+ a.mrnm = 0 -+ a.mpos=200 -+ a.isize = 0 -+ a.qual ="1234" * 3 -+ # todo: create tags -+ return a -+ -+ def testNegativeIntegers( self ): -+ x = -2 -+ aligned_read = self.makeRead() -+ aligned_read.tags = [("XD", int(x) ) ] -+ # print (aligned_read.tags) -+ -+ def testNegativeIntegers2( self ): -+ x = -2 -+ r = self.makeRead() -+ r.tags = [("XD", int(x) ) ] -+ outfile = pysam.Samfile( "test.bam", -+ "wb", -+ referencenames = ("chr1",), -+ referencelengths = (1000,) ) -+ outfile.write (r ) -+ outfile.close() -+ -+ def testCigarString( self ): -+ r = self.makeRead() -+ self.assertEqual( r.cigarstring, "10M1D25M" ) -+ r.cigarstring = "20M10D20M" -+ self.assertEqual( r.cigar, [(0,20), (2,10), (0,20)]) -+ -+ def testLongTags( self ): -+ '''see issue 115''' -+ -+ r = self.makeRead() -+ rg = 'HS2000-899_199.L3' -+ tags = [('XC', 85), ('XT', 'M'), ('NM', 5), ('SM', 29), ('AM', 29), ('XM', 1), ('XO', 1), ('XG', 4), ('MD', '37^ACCC29T18'), ('XA','5,+11707,36M1I48M,2;21,-48119779,46M1I38M,2;hs37d5,-10060835,40M1D45M,3;5,+11508,36M1I48M,3;hs37d5,+6743812,36M1I48M,3;19,-59118894,46M1I38M,3;4,-191044002,6M1I78M,3;')] -+ -+ r.tags = tags -+ r.tags += [("RG",rg)] * 100 -+ tags += [("RG",rg)] * 100 -+ -+ self.assertEqual( tags, r.tags ) -+ -+class TestIteratorRow(unittest.TestCase): -+ -+ def setUp(self): -+ self.samfile=pysam.Samfile( "ex1.bam","rb" ) -+ -+ def checkRange( self, rnge ): -+ '''compare results from iterator with those from samtools.''' -+ ps = list(self.samfile.fetch(region=rnge)) -+ sa = list(pysam.view( "ex1.bam", rnge, raw = True) ) -+ self.assertEqual( len(ps), len(sa), "unequal number of results for range %s: %i != %i" % (rnge, len(ps), len(sa) )) -+ # check if the same reads are returned and in the same order -+ for line, (a, b) in enumerate( list(zip( ps, sa )) ): -+ d = b.split("\t") -+ self.assertEqual( a.qname, d[0], "line %i: read id mismatch: %s != %s" % (line, a.rname, d[0]) ) -+ self.assertEqual( a.pos, int(d[3])-1, "line %i: read position mismatch: %s != %s, \n%s\n%s\n" % \ -+ (line, a.pos, int(d[3])-1, -+ str(a), str(d) ) ) -+ if sys.version_info[0] < 3: -+ qual = d[10] -+ else: -+ qual = d[10].encode('ascii') -+ self.assertEqual( a.qual, qual, "line %i: quality mismatch: %s != %s, \n%s\n%s\n" % \ -+ (line, a.qual, qual, -+ str(a), str(d) ) ) -+ -+ def testIteratePerContig(self): -+ '''check random access per contig''' -+ for contig in self.samfile.references: -+ self.checkRange( contig ) -+ -+ def testIterateRanges(self): -+ '''check random access per range''' -+ for contig, length in zip(self.samfile.references, self.samfile.lengths): -+ for start in range( 1, length, 90): -+ self.checkRange( "%s:%i-%i" % (contig, start, start + 90) ) # this includes empty ranges -+ -+ def tearDown(self): -+ self.samfile.close() -+ -+ -+class TestIteratorRowAll(unittest.TestCase): -+ -+ def setUp(self): -+ self.samfile=pysam.Samfile( "ex1.bam","rb" ) -+ -+ def testIterate(self): -+ '''compare results from iterator with those from samtools.''' -+ ps = list(self.samfile.fetch()) -+ sa = list(pysam.view( "ex1.bam", raw = True) ) -+ self.assertEqual( len(ps), len(sa), "unequal number of results: %i != %i" % (len(ps), len(sa) )) -+ # check if the same reads are returned -+ for line, pair in enumerate( list(zip( ps, sa )) ): -+ data = pair[1].split("\t") -+ self.assertEqual( pair[0].qname, data[0], "read id mismatch in line %i: %s != %s" % (line, pair[0].rname, data[0]) ) -+ -+ def tearDown(self): -+ self.samfile.close() -+ -+class TestIteratorColumn(unittest.TestCase): -+ '''test iterator column against contents of ex4.bam.''' -+ -+ # note that samfile contains 1-based coordinates -+ # 1D means deletion with respect to reference sequence -+ # -+ mCoverages = { 'chr1' : [ 0 ] * 20 + [1] * 36 + [0] * (100 - 20 -35 ), -+ 'chr2' : [ 0 ] * 20 + [1] * 35 + [0] * (100 - 20 -35 ), -+ } -+ -+ def setUp(self): -+ self.samfile=pysam.Samfile( "ex4.bam","rb" ) -+ -+ def checkRange( self, contig, start = None, end = None, truncate = False ): -+ '''compare results from iterator with those from samtools.''' -+ # check if the same reads are returned and in the same order -+ for column in self.samfile.pileup(contig, start, end, truncate = truncate): -+ if truncate: -+ self.assertGreaterEqual( column.pos, start ) -+ self.assertLess( column.pos, end ) -+ thiscov = len(column.pileups) -+ refcov = self.mCoverages[self.samfile.getrname(column.tid)][column.pos] -+ self.assertEqual( thiscov, refcov, "wrong coverage at pos %s:%i %i should be %i" % (self.samfile.getrname(column.tid), column.pos, thiscov, refcov)) -+ -+ def testIterateAll(self): -+ '''check random access per contig''' -+ self.checkRange( None ) -+ -+ def testIteratePerContig(self): -+ '''check random access per contig''' -+ for contig in self.samfile.references: -+ self.checkRange( contig ) -+ -+ def testIterateRanges(self): -+ '''check random access per range''' -+ for contig, length in zip(self.samfile.references, self.samfile.lengths): -+ for start in range( 1, length, 90): -+ self.checkRange( contig, start, start + 90 ) # this includes empty ranges -+ -+ def testInverse( self ): -+ '''test the inverse, is point-wise pileup accurate.''' -+ for contig, refseq in list(self.mCoverages.items()): -+ refcolumns = sum(refseq) -+ for pos, refcov in enumerate( refseq ): -+ columns = list(self.samfile.pileup( contig, pos, pos+1) ) -+ if refcov == 0: -+ # if no read, no coverage -+ self.assertEqual( len(columns), refcov, "wrong number of pileup columns returned for position %s:%i, %i should be %i" %(contig,pos,len(columns), refcov) ) -+ elif refcov == 1: -+ # one read, all columns of the read are returned -+ self.assertEqual( len(columns), refcolumns, "pileup incomplete at position %i: got %i, expected %i " %\ -+ (pos, len(columns), refcolumns)) -+ -+ def testIterateTruncate( self ): -+ '''check random access per range''' -+ for contig, length in zip(self.samfile.references, self.samfile.lengths): -+ for start in range( 1, length, 90): -+ self.checkRange( contig, start, start + 90, truncate = True ) # this includes empty ranges -+ -+ def tearDown(self): -+ self.samfile.close() -+ -+class TestIteratorColumn2(unittest.TestCase): -+ '''test iterator column against contents of ex1.bam.''' -+ -+ def setUp(self): -+ self.samfile=pysam.Samfile( "ex1.bam","rb" ) -+ -+ def testStart( self ): -+ #print self.samfile.fetch().next().pos -+ #print self.samfile.pileup().next().pos -+ pass -+ -+ def testTruncate( self ): -+ '''see issue 107.''' -+ # note that ranges in regions start from 1 -+ p = self.samfile.pileup(region='chr1:170:172', truncate=True) -+ columns = [ x.pos for x in p ] -+ self.assertEqual( len(columns), 3) -+ self.assertEqual( columns, [169,170,171] ) -+ -+ p = self.samfile.pileup( 'chr1', 169, 172, truncate=True) -+ columns = [ x.pos for x in p ] -+ -+ self.assertEqual( len(columns), 3) -+ self.assertEqual( columns, [169,170,171] ) -+ -+class TestAlignedReadFromBam(unittest.TestCase): -+ -+ def setUp(self): -+ self.samfile=pysam.Samfile( "ex3.bam","rb" ) -+ self.reads=list(self.samfile.fetch()) -+ -+ def testARqname(self): -+ self.assertEqual( self.reads[0].qname, "read_28833_29006_6945", "read name mismatch in read 1: %s != %s" % (self.reads[0].qname, "read_28833_29006_6945") ) -+ self.assertEqual( self.reads[1].qname, "read_28701_28881_323b", "read name mismatch in read 2: %s != %s" % (self.reads[1].qname, "read_28701_28881_323b") ) -+ -+ def testARflag(self): -+ self.assertEqual( self.reads[0].flag, 99, "flag mismatch in read 1: %s != %s" % (self.reads[0].flag, 99) ) -+ self.assertEqual( self.reads[1].flag, 147, "flag mismatch in read 2: %s != %s" % (self.reads[1].flag, 147) ) -+ -+ def testARrname(self): -+ self.assertEqual( self.reads[0].rname, 0, "chromosome/target id mismatch in read 1: %s != %s" % (self.reads[0].rname, 0) ) -+ self.assertEqual( self.reads[1].rname, 1, "chromosome/target id mismatch in read 2: %s != %s" % (self.reads[1].rname, 1) ) -+ -+ def testARpos(self): -+ self.assertEqual( self.reads[0].pos, 33-1, "mapping position mismatch in read 1: %s != %s" % (self.reads[0].pos, 33-1) ) -+ self.assertEqual( self.reads[1].pos, 88-1, "mapping position mismatch in read 2: %s != %s" % (self.reads[1].pos, 88-1) ) -+ -+ def testARmapq(self): -+ self.assertEqual( self.reads[0].mapq, 20, "mapping quality mismatch in read 1: %s != %s" % (self.reads[0].mapq, 20) ) -+ self.assertEqual( self.reads[1].mapq, 30, "mapping quality mismatch in read 2: %s != %s" % (self.reads[1].mapq, 30) ) -+ -+ def testARcigar(self): -+ self.assertEqual( self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)], "read name length mismatch in read 1: %s != %s" % (self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)]) ) -+ self.assertEqual( self.reads[1].cigar, [(0, 35)], "read name length mismatch in read 2: %s != %s" % (self.reads[1].cigar, [(0, 35)]) ) -+ -+ def testARcigarstring(self): -+ self.assertEqual( self.reads[0].cigarstring, '10M1D25M' ) -+ self.assertEqual( self.reads[1].cigarstring, '35M' ) -+ -+ def testARmrnm(self): -+ self.assertEqual( self.reads[0].mrnm, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].mrnm, 0) ) -+ self.assertEqual( self.reads[1].mrnm, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].mrnm, 1) ) -+ self.assertEqual( self.reads[0].rnext, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].rnext, 0) ) -+ self.assertEqual( self.reads[1].rnext, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].rnext, 1) ) -+ -+ def testARmpos(self): -+ self.assertEqual( self.reads[0].mpos, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].mpos, 200-1) ) -+ self.assertEqual( self.reads[1].mpos, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].mpos, 500-1) ) -+ self.assertEqual( self.reads[0].pnext, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].pnext, 200-1) ) -+ self.assertEqual( self.reads[1].pnext, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].pnext, 500-1) ) -+ -+ def testARisize(self): -+ self.assertEqual( self.reads[0].isize, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].isize, 167) ) -+ self.assertEqual( self.reads[1].isize, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].isize, 412) ) -+ self.assertEqual( self.reads[0].tlen, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].tlen, 167) ) -+ self.assertEqual( self.reads[1].tlen, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].tlen, 412) ) -+ -+ def testARseq(self): -+ self.assertEqual( self.reads[0].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 1: %s != %s" % (self.reads[0].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") ) -+ self.assertEqual( self.reads[1].seq, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "sequence size mismatch in read 2: %s != %s" % (self.reads[1].seq, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA") ) -+ self.assertEqual( self.reads[3].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 4: %s != %s" % (self.reads[3].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") ) -+ -+ def testARqual(self): -+ self.assertEqual( self.reads[0].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 1: %s != %s" % (self.reads[0].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") ) -+ self.assertEqual( self.reads[1].qual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "quality string mismatch in read 2: %s != %s" % (self.reads[1].qual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<") ) -+ self.assertEqual( self.reads[3].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 3: %s != %s" % (self.reads[3].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") ) -+ -+ def testARquery(self): -+ self.assertEqual( self.reads[0].query, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "query mismatch in read 1: %s != %s" % (self.reads[0].query, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") ) -+ self.assertEqual( self.reads[1].query, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "query size mismatch in read 2: %s != %s" % (self.reads[1].query, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA") ) -+ self.assertEqual( self.reads[3].query, b"TAGCTAGCTACCTATATCTTGGTCTT", "query mismatch in read 4: %s != %s" % (self.reads[3].query, b"TAGCTAGCTACCTATATCTTGGTCTT") ) -+ -+ def testARqqual(self): -+ self.assertEqual( self.reads[0].qqual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "qquality string mismatch in read 1: %s != %s" % (self.reads[0].qqual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") ) -+ self.assertEqual( self.reads[1].qqual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "qquality string mismatch in read 2: %s != %s" % (self.reads[1].qqual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<") ) -+ self.assertEqual( self.reads[3].qqual, b"<<<<<<<<<<<<<<<<<:<9/,&,22", "qquality string mismatch in read 3: %s != %s" % (self.reads[3].qqual, b"<<<<<<<<<<<<<<<<<:<9/,&,22") ) -+ -+ def testPresentOptionalFields(self): -+ self.assertEqual( self.reads[0].opt('NM'), 1, "optional field mismatch in read 1, NM: %s != %s" % (self.reads[0].opt('NM'), 1) ) -+ self.assertEqual( self.reads[0].opt('RG'), 'L1', "optional field mismatch in read 1, RG: %s != %s" % (self.reads[0].opt('RG'), 'L1') ) -+ self.assertEqual( self.reads[1].opt('RG'), 'L2', "optional field mismatch in read 2, RG: %s != %s" % (self.reads[1].opt('RG'), 'L2') ) -+ self.assertEqual( self.reads[1].opt('MF'), 18, "optional field mismatch in read 2, MF: %s != %s" % (self.reads[1].opt('MF'), 18) ) -+ -+ def testPairedBools(self): -+ self.assertEqual( self.reads[0].is_paired, True, "is paired mismatch in read 1: %s != %s" % (self.reads[0].is_paired, True) ) -+ self.assertEqual( self.reads[1].is_paired, True, "is paired mismatch in read 2: %s != %s" % (self.reads[1].is_paired, True) ) -+ self.assertEqual( self.reads[0].is_proper_pair, True, "is proper pair mismatch in read 1: %s != %s" % (self.reads[0].is_proper_pair, True) ) -+ self.assertEqual( self.reads[1].is_proper_pair, True, "is proper pair mismatch in read 2: %s != %s" % (self.reads[1].is_proper_pair, True) ) -+ -+ def testTags( self ): -+ self.assertEqual( self.reads[0].tags, -+ [('NM', 1), ('RG', 'L1'), -+ ('PG', 'P1'), ('XT', 'U')] ) -+ self.assertEqual( self.reads[1].tags, -+ [('MF', 18), ('RG', 'L2'), -+ ('PG', 'P2'),('XT', 'R') ] ) -+ -+ def testOpt( self ): -+ self.assertEqual( self.reads[0].opt("XT"), "U" ) -+ self.assertEqual( self.reads[1].opt("XT"), "R" ) -+ -+ def testMissingOpt( self ): -+ self.assertRaises( KeyError, self.reads[0].opt, "XP" ) -+ -+ def testEmptyOpt( self ): -+ self.assertRaises( KeyError, self.reads[2].opt, "XT" ) -+ -+ def tearDown(self): -+ self.samfile.close() -+ -+class TestAlignedReadFromSam(TestAlignedReadFromBam): -+ -+ def setUp(self): -+ self.samfile=pysam.Samfile( "ex3.sam","r" ) -+ self.reads=list(self.samfile.fetch()) -+ -+# needs to be implemented -+# class TestAlignedReadFromSamWithoutHeader(TestAlignedReadFromBam): -+# -+# def setUp(self): -+# self.samfile=pysam.Samfile( "ex7.sam","r" ) -+# self.reads=list(self.samfile.fetch()) -+ -+class TestHeaderSam(unittest.TestCase): -+ -+ header = {'SQ': [{'LN': 1575, 'SN': 'chr1'}, -+ {'LN': 1584, 'SN': 'chr2'}], -+ 'RG': [{'LB': 'SC_1', 'ID': 'L1', 'SM': 'NA12891', 'PU': 'SC_1_10', "CN":"name:with:colon"}, -+ {'LB': 'SC_2', 'ID': 'L2', 'SM': 'NA12891', 'PU': 'SC_2_12', "CN":"name:with:colon"}], -+ 'PG': [{'ID': 'P1', 'VN': '1.0'}, {'ID': 'P2', 'VN': '1.1'}], -+ 'HD': {'VN': '1.0'}, -+ 'CO' : [ 'this is a comment', 'this is another comment'], -+ } -+ -+ def compareHeaders( self, a, b ): -+ '''compare two headers a and b.''' -+ for ak,av in a.items(): -+ self.assertTrue( ak in b, "key '%s' not in '%s' " % (ak,b) ) -+ self.assertEqual( av, b[ak] ) -+ -+ def setUp(self): -+ self.samfile=pysam.Samfile( "ex3.sam","r" ) -+ -+ def testHeaders(self): -+ self.compareHeaders( self.header, self.samfile.header ) -+ self.compareHeaders( self.samfile.header, self.header ) -+ -+ def testNameMapping( self ): -+ for x, y in enumerate( ("chr1", "chr2")): -+ tid = self.samfile.gettid( y ) -+ ref = self.samfile.getrname( x ) -+ self.assertEqual( tid, x ) -+ self.assertEqual( ref, y ) -+ -+ self.assertEqual( self.samfile.gettid("chr?"), -1 ) -+ self.assertRaises( ValueError, self.samfile.getrname, 2 ) -+ -+ def tearDown(self): -+ self.samfile.close() -+ -+class TestHeaderBam(TestHeaderSam): -+ -+ def setUp(self): -+ self.samfile=pysam.Samfile( "ex3.bam","rb" ) -+ -+ -+class TestHeader1000Genomes( unittest.TestCase ): -+ -+ # bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase2b_alignment/data/NA07048/exome_alignment/NA07048.unmapped.ILLUMINA.bwa.CEU.exome.20120522_p2b.bam" -+ bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase3_EX_or_LC_only_alignment/data/HG00104/alignment/HG00104.chrom11.ILLUMINA.bwa.GBR.low_coverage.20130415.bam" -+ -+ def testRead( self ): -+ -+ # Skip fetching files from web when building the package -+ #f = pysam.Samfile( self.bamfile, "rb" ) -+ #data = f.header.copy() -+ #self.assertTrue( data ) -+ self.assertTrue( True ) -+ -+class TestUnmappedReads(unittest.TestCase): -+ -+ def testSAM(self): -+ samfile=pysam.Samfile( "ex5.sam","r" ) -+ self.assertEqual( len(list(samfile.fetch( until_eof = True))), 2 ) -+ samfile.close() -+ -+ def testBAM(self): -+ samfile=pysam.Samfile( "ex5.bam","rb" ) -+ self.assertEqual( len(list(samfile.fetch( until_eof = True))), 2 ) -+ samfile.close() -+ -+class TestPileupObjects(unittest.TestCase): -+ -+ def setUp(self): -+ self.samfile=pysam.Samfile( "ex1.bam","rb" ) -+ -+ def testPileupColumn(self): -+ for pcolumn1 in self.samfile.pileup( region="chr1:105" ): -+ if pcolumn1.pos == 104: -+ self.assertEqual( pcolumn1.tid, 0, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn1.tid, 0) ) -+ self.assertEqual( pcolumn1.pos, 105-1, "position mismatch in position 1: %s != %s" % (pcolumn1.pos, 105-1) ) -+ self.assertEqual( pcolumn1.n, 2, "# reads mismatch in position 1: %s != %s" % (pcolumn1.n, 2) ) -+ for pcolumn2 in self.samfile.pileup( region="chr2:1480" ): -+ if pcolumn2.pos == 1479: -+ self.assertEqual( pcolumn2.tid, 1, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn2.tid, 1) ) -+ self.assertEqual( pcolumn2.pos, 1480-1, "position mismatch in position 1: %s != %s" % (pcolumn2.pos, 1480-1) ) -+ self.assertEqual( pcolumn2.n, 12, "# reads mismatch in position 1: %s != %s" % (pcolumn2.n, 12) ) -+ -+ def testPileupRead(self): -+ for pcolumn1 in self.samfile.pileup( region="chr1:105" ): -+ if pcolumn1.pos == 104: -+ self.assertEqual( len(pcolumn1.pileups), 2, "# reads aligned to column mismatch in position 1: %s != %s" % (len(pcolumn1.pileups), 2) ) -+# self.assertEqual( pcolumn1.pileups[0] # need to test additional properties here -+ -+ def tearDown(self): -+ self.samfile.close() -+ -+ def testIteratorOutOfScope( self ): -+ '''test if exception is raised if pileup col is accessed after iterator is exhausted.''' -+ -+ for pileupcol in self.samfile.pileup(): -+ pass -+ -+ self.assertRaises( ValueError, getattr, pileupcol, "pileups" ) -+ -+class TestContextManager(unittest.TestCase): -+ -+ def testManager( self ): -+ with pysam.Samfile('ex1.bam', 'rb') as samfile: -+ samfile.fetch() -+ self.assertEqual( samfile._isOpen(), False ) -+ -+class TestExceptions(unittest.TestCase): -+ -+ def setUp(self): -+ self.samfile=pysam.Samfile( "ex1.bam","rb" ) -+ -+ def testMissingFile(self): -+ -+ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.bam", "rb" ) -+ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.sam", "r" ) -+ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.bam", "r" ) -+ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.sam", "rb" ) -+ -+ def testBadContig(self): -+ self.assertRaises( ValueError, self.samfile.fetch, "chr88" ) -+ -+ def testMeaninglessCrap(self): -+ self.assertRaises( ValueError, self.samfile.fetch, "skljf" ) -+ -+ def testBackwardsOrderNewFormat(self): -+ self.assertRaises( ValueError, self.samfile.fetch, 'chr1', 100, 10 ) -+ -+ def testBackwardsOrderOldFormat(self): -+ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:100-10") -+ -+ def testOutOfRangeNegativeNewFormat(self): -+ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 5, -10 ) -+ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 5, 0 ) -+ self.assertRaises( ValueError, self.samfile.fetch, "chr1", -5, -10 ) -+ -+ self.assertRaises( ValueError, self.samfile.count, "chr1", 5, -10 ) -+ self.assertRaises( ValueError, self.samfile.count, "chr1", 5, 0 ) -+ self.assertRaises( ValueError, self.samfile.count, "chr1", -5, -10 ) -+ -+ def testOutOfRangeNegativeOldFormat(self): -+ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-10" ) -+ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-0" ) -+ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5--10" ) -+ -+ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-10" ) -+ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-0" ) -+ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5--10" ) -+ -+ def testOutOfRangNewFormat(self): -+ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999, 99999999999 ) -+ self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999, 99999999999 ) -+ -+ def testOutOfRangeLargeNewFormat(self): -+ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 ) -+ self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 ) -+ -+ def testOutOfRangeLargeOldFormat(self): -+ self.assertRaises( ValueError, self.samfile.fetch, "chr1:99999999999999999-999999999999999999" ) -+ self.assertRaises( ValueError, self.samfile.count, "chr1:99999999999999999-999999999999999999" ) -+ -+ def testZeroToZero(self): -+ '''see issue 44''' -+ self.assertEqual( len(list(self.samfile.fetch('chr1', 0, 0))), 0) -+ -+ def tearDown(self): -+ self.samfile.close() -+ -+class TestWrongFormat(unittest.TestCase): -+ '''test cases for opening files not in bam/sam format.''' -+ -+ def testOpenSamAsBam( self ): -+ self.assertRaises( ValueError, pysam.Samfile, 'ex1.sam', 'rb' ) -+ -+ def testOpenBamAsSam( self ): -+ # test fails, needs to be implemented. -+ # sam.fetch() fails on reading, not on opening -+ # self.assertRaises( ValueError, pysam.Samfile, 'ex1.bam', 'r' ) -+ pass -+ -+ def testOpenFastaAsSam( self ): -+ # test fails, needs to be implemented. -+ # sam.fetch() fails on reading, not on opening -+ # self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'r' ) -+ pass -+ -+ def testOpenFastaAsBam( self ): -+ self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'rb' ) -+ -+class TestFastaFile(unittest.TestCase): -+ -+ mSequences = { 'chr1' : -+ b"CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCCATGGCCCAGCATTAGGGAGCTGTGGACCCTGCAGCCTGGCTGTGGGGGCCGCAGTGGCTGAGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCACAGGGGCTTAACCTCTGGTGACTGCCAGAGCTGCTGGCAAGCTAGAGTCCCATTTGGAGCCCCTCTAAGCCGTTCTATTTGTAATGAAAACTATATTTATGCTATTCAGTTCTAAATATAGAAATTGAAACAGCTGTGTTTAGTGCCTTTGTTCAACCCCCTTGCAACAACCTTGAGAACCCCAGGGAATTTGTCAATGTCAGGGAAGGAGCATTTTGTCAGTTACCAAATGTGTTTATTACCAGAGGGATGGAGGGAAGAGGGACGCTGAAGAACTTTGATGCCCTCTTCTTCCAAAGATGAAACGCGTAACTGCGCTCTCATTCACTCCAGCTCCCTGTCACCCAATGGACCTGTGATATCTGGATTCTGGGAAATTCTTCATCCTGGACCCTGAGAGATTCTGCAGCCCAGCTCCAGATTGCTTGTGGTCTGACAGGCTGCAACTGTGAGCCATCACAATGAACAACAGGAAGAAAAGGTCTTTCAAAAGGTGATGTGTGTTCTCATCAACCTCATACACACACATGGTTTAGGGGTATAATACCTCTACATGGCTGATTATGAAAACAATGTTCCCCAGATACCATCCCTGTCTTACTTCCAGCTCCCCAGAGGGAAAGCTTTCAACGCTTCTAGCCATTTCTTTTGGCATTTGCCTTCAGACCCTACACGAATGCGTCTCTACCACAGGGGGCTGCGCGGTTTCCCATCATGAAGCACTGAACTTCCACGTCTCATCTAGGGGAACAGGGAGGTGCACTAATGCGCTCCACGCCCAAGCCCTTCTCACAGTTTCTGCCCCCAGCATGGTTGTACTGGGCAATACATGAGATTATTAGGAAATGCTTTACTGTCATAACTATGAAGAGACTATTGCCAGATGAACCACACATTAATACTATGTTTCTTATCTGCACATTACTACCCTGCAATTAATATAATTGTGTCCATGTACACACGCTGTCCTATGTACTTATCATGACTCTATCCCAAATTCCCAATTACGTCCTATCTTCTTCTTAGGGAAGAACAGCTTAGGTATCAATTTGGTGTTCTGTGTAAAGTCTCAGGGAGCCGTCCGTGTCCTCCCATCTGGCCTCGTCCACACTGGTTCTCTTGAAAGCTTGGGCTGTAATGATGCCCCTTGGCCATCACCCAGTCCCTGCCCCATCTCTTGTAATCTCTCTCCTTTTTGCTGCATCCCTGTCTTCCTCTGTCTTGATTTACTTGTTGTTGGTTTTCTGTTTCTTTGTTTGATTTGGTGGAAGACATAATCCCACGCTTCCTATGGAAAGGTTGTTGGGAGATTTTTAATGATTCCTCAATGTTAAAATGTCTATTTTTGTCTTGACACCCAACTAATATTTGTCTGAGCAAAACAGTCTAGATGAGAGAGAACTTCCCTGGAGGTCTGATGGCGTTTCTCCCTCGTCTTCTTA", -+ 'chr2' : -+ b"TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAAGAAATTACAAAATATAGTTGAAAGCTCTAACAATAGACTAAACCAAGCAGAAGAAAGAGGTTCAGAACTTGAAGACAAGTCTCTTATGAATTAACCCAGTCAGACAAAAATAAAGAAAAAAATTTTAAAAATGAACAGAGCTTTCAAGAAGTATGAGATTATGTAAAGTAACTGAACCTATGAGTCACAGGTATTCCTGAGGAAAAAGAAAAAGTGAGAAGTTTGGAAAAACTATTTGAGGAAGTAATTGGGGAAAACCTCTTTAGTCTTGCTAGAGATTTAGACATCTAAATGAAAGAGGCTCAAAGAATGCCAGGAAGATACATTGCAAGACAGACTTCATCAAGATATGTAGTCATCAGACTATCTAAAGTCAACATGAAGGAAAAAAATTCTAAAATCAGCAAGAGAAAAGCATACAGTCATCTATAAAGGAAATCCCATCAGAATAACAATGGGCTTCTCAGCAGAAACCTTACAAGCCAGAAGAGATTGGATCTAATTTTTGGACTTCTTAAAGAAAAAAAAACCTGTCAAACACGAATGTTATGCCCTGCTAAACTAAGCATCATAAATGAAGGGGAAATAAAGTCAAGTCTTTCCTGACAAGCAAATGCTAAGATAATTCATCATCACTAAACCAGTCCTATAAGAAATGCTCAAAAGAATTGTAAAAGTCAAAATTAAAGTTCAATACTCACCATCATAAATACACACAAAAGTACAAAACTCACAGGTTTTATAAAACAATTGAGACTACAGAGCAACTAGGTAAAAAATTAACATTACAACAGGAACAAAACCTCATATATCAATATTAACTTTGAATAAAAAGGGATTAAATTCCCCCACTTAAGAGATATAGATTGGCAGAACAGATTTAAAAACATGAACTAACTATATGCTGTTTACAAGAAACTCATTAATAAAGACATGAGTTCAGGTAAAGGGGTGGAAAAAGATGTTCTACGCAAACAGAAACCAAATGAGAGAAGGAGTAGCTATACTTATATCAGATAAAGCACACTTTAAATCAACAACAGTAAAATAAAACAAAGGAGGTCATCATACAATGATAAAAAGATCAATTCAGCAAGAAGATATAACCATCCTACTAAATACATATGCACCTAACACAAGACTACCCAGATTCATAAAACAAATACTACTAGACCTAAGAGGGATGAGAAATTACCTAATTGGTACAATGTACAATATTCTGATGATGGTTACACTAAAAGCCCATACTTTACTGCTACTCAATATATCCATGTAACAAATCTGCGCTTGTACTTCTAAATCTATAAAAAAATTAAAATTTAACAAAAGTAAATAAAACACATAGCTAAAACTAAAAAAGCAAAAACAAAAACTATGCTAAGTATTGGTAAAGATGTGGGGAAAAAAGTAAACTCTCAAATATTGCTAGTGGGAGTATAAATTGTTTTCCACTTTGGAAAACAATTTGGTAATTTCGTTTTTTTTTTTTTCTTTTCTCTTTTTTTTTTTTTTTTTTTTGCATGCCAGAAAAAAATATTTACAGTAACT", -+ } -+ -+ def setUp(self): -+ self.file=pysam.Fastafile( "ex1.fa" ) -+ -+ def testFetch(self): -+ for id, seq in list(self.mSequences.items()): -+ self.assertEqual( seq, self.file.fetch( id ) ) -+ for x in range( 0, len(seq), 10): -+ self.assertEqual( seq[x:x+10], self.file.fetch( id, x, x+10) ) -+ # test x:end -+ self.assertEqual( seq[x:], self.file.fetch( id, x) ) -+ # test 0:x -+ self.assertEqual( seq[:x], self.file.fetch( id, None, x) ) -+ -+ -+ # unknown sequence returns "" -+ self.assertEqual( b"", self.file.fetch("chr12") ) -+ -+ def testOutOfRangeAccess( self ): -+ '''test out of range access.''' -+ # out of range access returns an empty string -+ for contig, s in self.mSequences.items(): -+ self.assertEqual( self.file.fetch( contig, len(s), len(s)+1), b"" ) -+ -+ self.assertEqual( self.file.fetch( "chr3", 0 , 100), b"" ) -+ -+ def testFetchErrors( self ): -+ self.assertRaises( ValueError, self.file.fetch ) -+ self.assertRaises( ValueError, self.file.fetch, "chr1", -1, 10 ) -+ self.assertRaises( ValueError, self.file.fetch, "chr1", 20, 10 ) -+ -+ def testLength( self ): -+ self.assertEqual( len(self.file), 2 ) -+ -+ def tearDown(self): -+ self.file.close() -+ -+class TestAlignedRead(unittest.TestCase): -+ '''tests to check if aligned read can be constructed -+ and manipulated. -+ ''' -+ -+ def checkFieldEqual( self, read1, read2, exclude = []): -+ '''check if two reads are equal by comparing each field.''' -+ -+ for x in ("qname", "seq", "flag", -+ "rname", "pos", "mapq", "cigar", -+ "mrnm", "mpos", "isize", "qual", -+ "is_paired", "is_proper_pair", -+ "is_unmapped", "mate_is_unmapped", -+ "is_reverse", "mate_is_reverse", -+ "is_read1", "is_read2", -+ "is_secondary", "is_qcfail", -+ "is_duplicate", "bin"): -+ if x in exclude: continue -+ self.assertEqual( getattr(read1, x), getattr(read2,x), "attribute mismatch for %s: %s != %s" % -+ (x, getattr(read1, x), getattr(read2,x))) -+ -+ def testEmpty( self ): -+ a = pysam.AlignedRead() -+ self.assertEqual( a.qname, None ) -+ self.assertEqual( a.seq, None ) -+ self.assertEqual( a.qual, None ) -+ self.assertEqual( a.flag, 0 ) -+ self.assertEqual( a.rname, 0 ) -+ self.assertEqual( a.mapq, 0 ) -+ self.assertEqual( a.cigar, None ) -+ self.assertEqual( a.tags, [] ) -+ self.assertEqual( a.mrnm, 0 ) -+ self.assertEqual( a.mpos, 0 ) -+ self.assertEqual( a.isize, 0 ) -+ -+ def buildRead( self ): -+ '''build an example read.''' -+ -+ a = pysam.AlignedRead() -+ a.qname = "read_12345" -+ a.seq="ACGT" * 10 -+ a.flag = 0 -+ a.rname = 0 -+ a.pos = 20 -+ a.mapq = 20 -+ a.cigar = ( (0,10), (2,1), (0,9), (1,1), (0,20) ) -+ a.mrnm = 0 -+ a.mpos=200 -+ a.isize=167 -+ a.qual="1234" * 10 -+ # todo: create tags -+ return a -+ -+ def testUpdate( self ): -+ '''check if updating fields affects other variable length data -+ ''' -+ a = self.buildRead() -+ b = self.buildRead() -+ -+ # check qname -+ b.qname = "read_123" -+ self.checkFieldEqual( a, b, "qname" ) -+ b.qname = "read_12345678" -+ self.checkFieldEqual( a, b, "qname" ) -+ b.qname = "read_12345" -+ self.checkFieldEqual( a, b) -+ -+ # check cigar -+ b.cigar = ( (0,10), ) -+ self.checkFieldEqual( a, b, "cigar" ) -+ b.cigar = ( (0,10), (2,1), (0,10) ) -+ self.checkFieldEqual( a, b, "cigar" ) -+ b.cigar = ( (0,10), (2,1), (0,9), (1,1), (0,20) ) -+ self.checkFieldEqual( a, b) -+ -+ # check seq -+ b.seq = "ACGT" -+ self.checkFieldEqual( a, b, ("seq", "qual") ) -+ b.seq = "ACGT" * 3 -+ self.checkFieldEqual( a, b, ("seq", "qual") ) -+ b.seq = "ACGT" * 10 -+ self.checkFieldEqual( a, b, ("qual",)) -+ -+ # reset qual -+ b = self.buildRead() -+ -+ # check flags: -+ for x in ( -+ "is_paired", "is_proper_pair", -+ "is_unmapped", "mate_is_unmapped", -+ "is_reverse", "mate_is_reverse", -+ "is_read1", "is_read2", -+ "is_secondary", "is_qcfail", -+ "is_duplicate"): -+ setattr( b, x, True ) -+ self.assertEqual( getattr(b, x), True ) -+ self.checkFieldEqual( a, b, ("flag", x,) ) -+ setattr( b, x, False ) -+ self.assertEqual( getattr(b, x), False ) -+ self.checkFieldEqual( a, b ) -+ -+ def testLargeRead( self ): -+ '''build an example read.''' -+ -+ a = pysam.AlignedRead() -+ a.qname = "read_12345" -+ a.seq="ACGT" * 200 -+ a.flag = 0 -+ a.rname = 0 -+ a.pos = 20 -+ a.mapq = 20 -+ a.cigar = ( (0, 4 * 200), ) -+ a.mrnm = 0 -+ a.mpos=200 -+ a.isize=167 -+ a.qual="1234" * 200 -+ -+ return a -+ -+ def testTagParsing( self ): -+ '''test for tag parsing -+ -+ see http://groups.google.com/group/pysam-user-group/browse_thread/thread/67ca204059ea465a -+ ''' -+ samfile=pysam.Samfile( "ex8.bam","rb" ) -+ -+ for entry in samfile: -+ before = entry.tags -+ entry.tags = entry.tags -+ after = entry.tags -+ self.assertEqual( after, before ) -+ -+ def testUpdateTlen( self ): -+ '''check if updating tlen works''' -+ a = self.buildRead() -+ oldlen = a.tlen -+ oldlen *= 2 -+ a.tlen = oldlen -+ self.assertEqual( a.tlen, oldlen ) -+ -+ def testPositions( self ): -+ a = self.buildRead() -+ self.assertEqual( a.positions, -+ [20, 21, 22, 23, 24, 25, 26, 27, 28, 29, -+ 31, 32, 33, 34, 35, 36, 37, 38, 39, -+ 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, -+ 50, 51, 52, 53, 54, 55, 56, 57, 58, 59] ) -+ -+ self.assertEqual( a.aligned_pairs, -+ [(0, 20), (1, 21), (2, 22), (3, 23), (4, 24), -+ (5, 25), (6, 26), (7, 27), (8, 28), (9, 29), -+ (None, 30), -+ (10, 31), (11, 32), (12, 33), (13, 34), (14, 35), -+ (15, 36), (16, 37), (17, 38), (18, 39), (19, None), -+ (20, 40), (21, 41), (22, 42), (23, 43), (24, 44), -+ (25, 45), (26, 46), (27, 47), (28, 48), (29, 49), -+ (30, 50), (31, 51), (32, 52), (33, 53), (34, 54), -+ (35, 55), (36, 56), (37, 57), (38, 58), (39, 59)] ) -+ -+ self.assertEqual( a.positions, [x[1] for x in a.aligned_pairs if x[0] != None and x[1] != None] ) -+ # alen is the length of the aligned read in genome -+ self.assertEqual( a.alen, a.aligned_pairs[-1][0] + 1 ) -+ # aend points to one beyond last aligned base in ref -+ self.assertEqual( a.positions[-1], a.aend - 1 ) -+ -+class TestDeNovoConstruction(unittest.TestCase): -+ '''check BAM/SAM file construction using ex6.sam -+ -+ (note these are +1 coordinates): -+ -+ read_28833_29006_6945 99 chr1 33 20 10M1D25M = 200 167 AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG <<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<< NM:i:1 RG:Z:L1 -+ read_28701_28881_323b 147 chr2 88 30 35M = 500 412 ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA <<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<< MF:i:18 RG:Z:L2 -+ ''' -+ -+ header = { 'HD': {'VN': '1.0'}, -+ 'SQ': [{'LN': 1575, 'SN': 'chr1'}, -+ {'LN': 1584, 'SN': 'chr2'}], } -+ -+ bamfile = "ex6.bam" -+ samfile = "ex6.sam" -+ -+ def checkFieldEqual( self, read1, read2, exclude = []): -+ '''check if two reads are equal by comparing each field.''' -+ -+ for x in ("qname", "seq", "flag", -+ "rname", "pos", "mapq", "cigar", -+ "mrnm", "mpos", "isize", "qual", -+ "bin", -+ "is_paired", "is_proper_pair", -+ "is_unmapped", "mate_is_unmapped", -+ "is_reverse", "mate_is_reverse", -+ "is_read1", "is_read2", -+ "is_secondary", "is_qcfail", -+ "is_duplicate"): -+ if x in exclude: continue -+ self.assertEqual( getattr(read1, x), getattr(read2,x), "attribute mismatch for %s: %s != %s" % -+ (x, getattr(read1, x), getattr(read2,x))) -+ -+ def setUp( self ): -+ -+ a = pysam.AlignedRead() -+ a.qname = "read_28833_29006_6945" -+ a.seq="AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG" -+ a.flag = 99 -+ a.rname = 0 -+ a.pos = 32 -+ a.mapq = 20 -+ a.cigar = ( (0,10), (2,1), (0,25) ) -+ a.mrnm = 0 -+ a.mpos=199 -+ a.isize=167 -+ a.qual="<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<" -+ a.tags = ( ("NM", 1), -+ ("RG", "L1") ) -+ -+ b = pysam.AlignedRead() -+ b.qname = "read_28701_28881_323b" -+ b.seq="ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA" -+ b.flag = 147 -+ b.rname = 1 -+ b.pos = 87 -+ b.mapq = 30 -+ b.cigar = ( (0,35), ) -+ b.mrnm = 1 -+ b.mpos=499 -+ b.isize=412 -+ b.qual="<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<" -+ b.tags = ( ("MF", 18), -+ ("RG", "L2") ) -+ -+ self.reads = (a,b) -+ -+ def testSAMWholeFile( self ): -+ -+ tmpfilename = "tmp_%i.sam" % id(self) -+ -+ outfile = pysam.Samfile( tmpfilename, "wh", header = self.header ) -+ -+ for x in self.reads: outfile.write( x ) -+ outfile.close() -+ self.assertTrue( checkBinaryEqual( tmpfilename, self.samfile ), -+ "mismatch when construction SAM file, see %s %s" % (tmpfilename, self.samfile)) -+ -+ os.unlink( tmpfilename ) -+ -+ def testBAMPerRead( self ): -+ '''check if individual reads are binary equal.''' -+ infile = pysam.Samfile( self.bamfile, "rb") -+ -+ others = list(infile) -+ for denovo, other in zip( others, self.reads): -+ self.checkFieldEqual( other, denovo ) -+ self.assertEqual( other.compare( denovo ), 0 ) -+ -+ def testSAMPerRead( self ): -+ '''check if individual reads are binary equal.''' -+ infile = pysam.Samfile( self.samfile, "r") -+ -+ others = list(infile) -+ for denovo, other in zip( others, self.reads): -+ self.checkFieldEqual( other, denovo ) -+ self.assertEqual( other.compare( denovo), 0 ) -+ -+ def testBAMWholeFile( self ): -+ -+ tmpfilename = "tmp_%i.bam" % id(self) -+ -+ outfile = pysam.Samfile( tmpfilename, "wb", header = self.header ) -+ -+ for x in self.reads: outfile.write( x ) -+ outfile.close() -+ -+ self.assertTrue( checkBinaryEqual( tmpfilename, self.bamfile ), -+ "mismatch when construction BAM file, see %s %s" % (tmpfilename, self.bamfile)) -+ -+ os.unlink( tmpfilename ) -+ -+class TestDeNovoConstructionUserTags(TestDeNovoConstruction): -+ '''test de novo construction with a header that contains lower-case tags.''' -+ -+ header = { 'HD': {'VN': '1.0'}, -+ 'SQ': [{'LN': 1575, 'SN': 'chr1'}, -+ {'LN': 1584, 'SN': 'chr2'}], -+ 'x1': {'A': 2, 'B': 5 }, -+ 'x3': {'A': 6, 'B': 5 }, -+ 'x2': {'A': 4, 'B': 5 } } -+ -+ bamfile = "example_user_header.bam" -+ samfile = "example_user_header.sam" -+ -+class TestEmptyHeader( unittest.TestCase ): -+ '''see issue 84.''' -+ -+ def testEmptyHeader( self ): -+ -+ s = pysam.Samfile('example_empty_header.bam') -+ self.assertEqual( s.header, {'SQ': [{'LN': 1000, 'SN': 'chr1'}]} ) -+ -+class TestBTagSam( unittest.TestCase ): -+ '''see issue 81.''' -+ -+ compare = [ [100, 1, 91, 0, 7, 101, 0, 201, 96, 204, 0, 0, 87, 109, 0, 7, 97, 112, 1, 12, 78, 197, 0, 7, 100, 95, 101, 202, 0, 6, 0, 1, 186, 0, 84, 0, 244, 0, 0, 324, 0, 107, 195, 101, 113, 0, 102, 0, 104, 3, 0, 101, 1, 0, 212, 6, 0, 0, 1, 0, 74, 1, 11, 0, 196, 2, 197, 103, 0, 108, 98, 2, 7, 0, 1, 2, 194, 0, 180, 0, 108, 0, 203, 104, 16, 5, 205, 0, 0, 0, 1, 1, 100, 98, 0, 0, 204, 6, 0, 79, 0, 0, 101, 7, 109, 90, 265, 1, 27, 10, 109, 102, 9, 0, 292, 0, 110, 0, 0, 102, 112, 0, 0, 84, 100, 103, 2, 81, 126, 0, 2, 90, 0, 15, 96, 15, 1, 0, 2, 0, 107, 92, 0, 0, 101, 3, 98, 15, 102, 13, 116, 116, 90, 93, 198, 0, 0, 0, 199, 92, 26, 495, 100, 5, 0, 100, 5, 209, 0, 92, 107, 90, 0, 0, 0, 0, 109, 194, 7, 94, 200, 0, 40, 197, 0, 11, 0, 0, 112, 110, 6, 4, 200, 28, 0, 196, 0, 203, 1, 129, 0, 0, 1, 0, 94, 0, 1, 0, 107, 5, 201, 3, 3, 100, 0, 121, 0, 7, 0, 1, 105, 306, 3, 86, 8, 183, 0, 12, 163, 17, 83, 22, 0, 0, 1, 8, 109, 103, 0, 0, 295, 0, 200, 16, 172, 3, 16, 182, 3, 11, 0, 0, 223, 111, 103, 0, 5, 225, 0, 95], -+ [-100,200,-300,-400], -+ [-100,12], -+ [12,15], -+ [-1.0,5.0,2.5] ] -+ -+ filename = 'example_btag.sam' -+ -+ def testRead( self ): -+ -+ s = pysam.Samfile(self.filename) -+ for x, read in enumerate(s): -+ if x == 0: -+ self.assertEqual( read.tags, [('RG', 'QW85I'), ('PG', 'tmap'), ('MD', '140'), ('NM', 0), ('AS', 140), ('FZ', [100, 1, 91, 0, 7, 101, 0, 201, 96, 204, 0, 0, 87, 109, 0, 7, 97, 112, 1, 12, 78, 197, 0, 7, 100, 95, 101, 202, 0, 6, 0, 1, 186, 0, 84, 0, 244, 0, 0, 324, 0, 107, 195, 101, 113, 0, 102, 0, 104, 3, 0, 101, 1, 0, 212, 6, 0, 0, 1, 0, 74, 1, 11, 0, 196, 2, 197, 103, 0, 108, 98, 2, 7, 0, 1, 2, 194, 0, 180, 0, 108, 0, 203, 104, 16, 5, 205, 0, 0, 0, 1, 1, 100, 98, 0, 0, 204, 6, 0, 79, 0, 0, 101, 7, 109, 90, 265, 1, 27, 10, 109, 102, 9, 0, 292, 0, 110, 0, 0, 102, 112, 0, 0, 84, 100, 103, 2, 81, 126, 0, 2, 90, 0, 15, 96, 15, 1, 0, 2, 0, 107, 92, 0, 0, 101, 3, 98, 15, 102, 13, 116, 116, 90, 93, 198, 0, 0, 0, 199, 92, 26, 495, 100, 5, 0, 100, 5, 209, 0, 92, 107, 90, 0, 0, 0, 0, 109, 194, 7, 94, 200, 0, 40, 197, 0, 11, 0, 0, 112, 110, 6, 4, 200, 28, 0, 196, 0, 203, 1, 129, 0, 0, 1, 0, 94, 0, 1, 0, 107, 5, 201, 3, 3, 100, 0, 121, 0, 7, 0, 1, 105, 306, 3, 86, 8, 183, 0, 12, 163, 17, 83, 22, 0, 0, 1, 8, 109, 103, 0, 0, 295, 0, 200, 16, 172, 3, 16, 182, 3, 11, 0, 0, 223, 111, 103, 0, 5, 225, 0, 95]), ('XA', 'map2-1'), ('XS', 53), ('XT', 38), ('XF', 1), ('XE', 0)] -+ ) -+ -+ fz = dict(read.tags)["FZ"] -+ self.assertEqual( fz, self.compare[x] ) -+ self.assertEqual( read.opt("FZ"), self.compare[x]) -+ -+ def testWrite( self ): -+ -+ s = pysam.Samfile(self.filename) -+ for read in s: -+ before = read.tags -+ read.tags = read.tags -+ after = read.tags -+ self.assertEqual( after, before ) -+ -+class TestBTagBam( TestBTagSam ): -+ filename = 'example_btag.bam' -+ -+class TestDoubleFetch(unittest.TestCase): -+ '''check if two iterators on the same bamfile are independent.''' -+ -+ def testDoubleFetch( self ): -+ -+ samfile1 = pysam.Samfile('ex1.bam', 'rb') -+ -+ for a,b in zip(samfile1.fetch(), samfile1.fetch()): -+ self.assertEqual( a.compare( b ), 0 ) -+ -+ def testDoubleFetchWithRegion( self ): -+ -+ samfile1 = pysam.Samfile('ex1.bam', 'rb') -+ chr, start, stop = 'chr1', 200, 3000000 -+ self.assertTrue(len(list(samfile1.fetch ( chr, start, stop))) > 0) #just making sure the test has something to catch -+ -+ for a,b in zip(samfile1.fetch( chr, start, stop), samfile1.fetch( chr, start, stop)): -+ self.assertEqual( a.compare( b ), 0 ) -+ -+ def testDoubleFetchUntilEOF( self ): -+ -+ samfile1 = pysam.Samfile('ex1.bam', 'rb') -+ -+ for a,b in zip(samfile1.fetch( until_eof = True), -+ samfile1.fetch( until_eof = True )): -+ self.assertEqual( a.compare( b), 0 ) -+ -+class TestRemoteFileFTP(unittest.TestCase): -+ '''test remote access. -+ -+ ''' -+ -+ # Need to find an ftp server without password on standard -+ # port. -+ -+ url = "ftp://ftp.sanger.ac.uk/pub/rd/humanSequences/CV.bam" -+ region = "1:1-1000" -+ -+ def testFTPView( self ): -+ return -+ result = pysam.view( self.url, self.region ) -+ self.assertEqual( len(result), 36 ) -+ -+ def testFTPFetch( self ): -+ return -+ samfile = pysam.Samfile(self.url, "rb") -+ result = list(samfile.fetch( region = self.region )) -+ self.assertEqual( len(result), 36 ) -+ -+class TestLargeOptValues( unittest.TestCase ): -+ -+ ints = ( 65536, 214748, 2147484, 2147483647 ) -+ floats = ( 65536.0, 214748.0, 2147484.0 ) -+ -+ def check( self, samfile ): -+ -+ i = samfile.fetch() -+ for exp in self.ints: -+ rr = next(i) -+ obs = rr.opt("ZP") -+ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr))) -+ -+ for exp in [ -x for x in self.ints ]: -+ rr = next(i) -+ obs = rr.opt("ZP") -+ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr))) -+ -+ for exp in self.floats: -+ rr = next(i) -+ obs = rr.opt("ZP") -+ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr))) -+ -+ for exp in [ -x for x in self.floats ]: -+ rr = next(i) -+ obs = rr.opt("ZP") -+ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr))) -+ -+ def testSAM( self ): -+ samfile = pysam.Samfile("ex10.sam", "r") -+ self.check( samfile ) -+ -+ def testBAM( self ): -+ samfile = pysam.Samfile("ex10.bam", "rb") -+ self.check( samfile ) -+ -+# class TestSNPCalls( unittest.TestCase ): -+# '''test pysam SNP calling ability.''' -+ -+# def checkEqual( self, a, b ): -+# for x in ("reference_base", -+# "pos", -+# "genotype", -+# "consensus_quality", -+# "snp_quality", -+# "mapping_quality", -+# "coverage" ): -+# self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" % -+# (x, getattr(a, x), getattr(b,x), str(a), str(b))) -+ -+# def testAllPositionsViaIterator( self ): -+# samfile = pysam.Samfile( "ex1.bam", "rb") -+# fastafile = pysam.Fastafile( "ex1.fa" ) -+# try: -+# refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base != "*"] -+# except pysam.SamtoolsError: -+# pass -+ -+# i = samfile.pileup( stepper = "samtools", fastafile = fastafile ) -+# calls = list(pysam.IteratorSNPCalls(i)) -+# for x,y in zip( refs, calls ): -+# self.checkEqual( x, y ) -+ -+# def testPerPositionViaIterator( self ): -+# # test pileup for each position. This is a slow operation -+# # so this test is disabled -+# return -+# samfile = pysam.Samfile( "ex1.bam", "rb") -+# fastafile = pysam.Fastafile( "ex1.fa" ) -+# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ): -+# if x.reference_base == "*": continue -+# i = samfile.pileup( x.chromosome, x.pos, x.pos+1, -+# fastafile = fastafile, -+# stepper = "samtools" ) -+# z = [ zz for zz in pysam.IteratorSamtools(i) if zz.pos == x.pos ] -+# self.assertEqual( len(z), 1 ) -+# self.checkEqual( x, z[0] ) -+ -+# def testPerPositionViaCaller( self ): -+# # test pileup for each position. This is a fast operation -+# samfile = pysam.Samfile( "ex1.bam", "rb") -+# fastafile = pysam.Fastafile( "ex1.fa" ) -+# i = samfile.pileup( stepper = "samtools", fastafile = fastafile ) -+# caller = pysam.SNPCaller( i ) -+ -+# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ): -+# if x.reference_base == "*": continue -+# call = caller.call( x.chromosome, x.pos ) -+# self.checkEqual( x, call ) -+ -+# class TestIndelCalls( unittest.TestCase ): -+# '''test pysam indel calling.''' -+ -+# def checkEqual( self, a, b ): -+ -+# for x in ("pos", -+# "genotype", -+# "consensus_quality", -+# "snp_quality", -+# "mapping_quality", -+# "coverage", -+# "first_allele", -+# "second_allele", -+# "reads_first", -+# "reads_second", -+# "reads_diff"): -+# if b.genotype == "*/*" and x == "second_allele": -+# # ignore test for second allele (positions chr2:439 and chr2:1512) -+# continue -+# self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" % -+# (x, getattr(a, x), getattr(b,x), str(a), str(b))) -+ -+# def testAllPositionsViaIterator( self ): -+ -+# samfile = pysam.Samfile( "ex1.bam", "rb") -+# fastafile = pysam.Fastafile( "ex1.fa" ) -+# try: -+# refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base == "*"] -+# except pysam.SamtoolsError: -+# pass -+ -+# i = samfile.pileup( stepper = "samtools", fastafile = fastafile ) -+# calls = [ x for x in list(pysam.IteratorIndelCalls(i)) if x != None ] -+# for x,y in zip( refs, calls ): -+# self.checkEqual( x, y ) -+ -+# def testPerPositionViaCaller( self ): -+# # test pileup for each position. This is a fast operation -+# samfile = pysam.Samfile( "ex1.bam", "rb") -+# fastafile = pysam.Fastafile( "ex1.fa" ) -+# i = samfile.pileup( stepper = "samtools", fastafile = fastafile ) -+# caller = pysam.IndelCaller( i ) -+ -+# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ): -+# if x.reference_base != "*": continue -+# call = caller.call( x.chromosome, x.pos ) -+# self.checkEqual( x, call ) -+ -+class TestLogging( unittest.TestCase ): -+ '''test around bug issue 42, -+ -+ failed in versions < 0.4 -+ ''' -+ -+ def check( self, bamfile, log ): -+ -+ if log: -+ logger = logging.getLogger('franklin') -+ logger.setLevel(logging.INFO) -+ formatter = logging.Formatter('%(asctime)s %(levelname)s %(message)s') -+ log_hand = logging.FileHandler('log.txt') -+ log_hand.setFormatter(formatter) -+ logger.addHandler(log_hand) -+ -+ bam = pysam.Samfile(bamfile, 'rb') -+ cols = bam.pileup() -+ self.assertTrue( True ) -+ -+ def testFail1( self ): -+ self.check( "ex9_fail.bam", False ) -+ self.check( "ex9_fail.bam", True ) -+ -+ def testNoFail1( self ): -+ self.check( "ex9_nofail.bam", False ) -+ self.check( "ex9_nofail.bam", True ) -+ -+ def testNoFail2( self ): -+ self.check( "ex9_nofail.bam", True ) -+ self.check( "ex9_nofail.bam", True ) -+ -+# TODOS -+# 1. finish testing all properties within pileup objects -+# 2. check exceptions and bad input problems (missing files, optional fields that aren't present, etc...) -+# 3. check: presence of sequence -+ -+class TestSamfileUtilityFunctions( unittest.TestCase ): -+ -+ def testCount( self ): -+ -+ samfile = pysam.Samfile( "ex1.bam", "rb" ) -+ -+ for contig in ("chr1", "chr2" ): -+ for start in range( 0, 2000, 100 ): -+ end = start + 1 -+ self.assertEqual( len( list( samfile.fetch( contig, start, end ) ) ), -+ samfile.count( contig, start, end ) ) -+ -+ # test empty intervals -+ self.assertEqual( len( list( samfile.fetch( contig, start, start ) ) ), -+ samfile.count( contig, start, start ) ) -+ -+ # test half empty intervals -+ self.assertEqual( len( list( samfile.fetch( contig, start ) ) ), -+ samfile.count( contig, start ) ) -+ -+ def testMate( self ): -+ '''test mate access.''' -+ -+ with open( "ex1.sam", "rb" ) as inf: -+ readnames = [ x.split(b"\t")[0] for x in inf.readlines() ] -+ if sys.version_info[0] >= 3: -+ readnames = [ name.decode('ascii') for name in readnames ] -+ -+ counts = collections.defaultdict( int ) -+ for x in readnames: counts[x] += 1 -+ -+ samfile = pysam.Samfile( "ex1.bam", "rb" ) -+ for read in samfile.fetch(): -+ if not read.is_paired: -+ self.assertRaises( ValueError, samfile.mate, read ) -+ elif read.mate_is_unmapped: -+ self.assertRaises( ValueError, samfile.mate, read ) -+ else: -+ if counts[read.qname] == 1: -+ self.assertRaises( ValueError, samfile.mate, read ) -+ else: -+ mate = samfile.mate( read ) -+ self.assertEqual( read.qname, mate.qname ) -+ self.assertEqual( read.is_read1, mate.is_read2 ) -+ self.assertEqual( read.is_read2, mate.is_read1 ) -+ self.assertEqual( read.pos, mate.mpos ) -+ self.assertEqual( read.mpos, mate.pos ) -+ -+ def testIndexStats( self ): -+ '''test if total number of mapped/unmapped reads is correct.''' -+ -+ samfile = pysam.Samfile( "ex1.bam", "rb" ) -+ self.assertEqual( samfile.mapped, 3235 ) -+ self.assertEqual( samfile.unmapped, 35 ) -+ -+class TestSamtoolsProxy( unittest.TestCase ): -+ '''tests for sanity checking access to samtools functions.''' -+ -+ def testIndex( self ): -+ self.assertRaises( IOError, pysam.index, "missing_file" ) -+ -+ def testView( self ): -+ # note that view still echos "open: No such file or directory" -+ self.assertRaises( pysam.SamtoolsError, pysam.view, "missing_file" ) -+ -+ def testSort( self ): -+ self.assertRaises( pysam.SamtoolsError, pysam.sort, "missing_file" ) -+ -+class TestSamfileIndex( unittest.TestCase): -+ -+ def testIndex( self ): -+ samfile = pysam.Samfile( "ex1.bam", "rb" ) -+ index = pysam.IndexedReads( samfile ) -+ index.build() -+ -+ reads = collections.defaultdict( int ) -+ -+ for read in samfile: reads[read.qname] += 1 -+ -+ for qname, counts in reads.items(): -+ found = list(index.find( qname )) -+ self.assertEqual( len(found), counts ) -+ for x in found: self.assertEqual( x.qname, qname ) -+ -+ -+if __name__ == "__main__": -+ # build data files -+ print ("building data files") -+ subprocess.call( "make", shell=True) -+ print ("starting tests") -+ unittest.main() -+ print ("completed tests") diff --git a/debian/patches/series b/debian/patches/series deleted file mode 100644 index ebb9930..0000000 --- a/debian/patches/series +++ /dev/null @@ -1,3 +0,0 @@ -fix_cleanup_tests.patch -do_not_use_distribute_setup.patch -offline-tests.patch diff --git a/debian/python-pysam-tests.README.Debian b/debian/python-pysam-tests.README.Debian deleted file mode 100644 index 6ec9300..0000000 --- a/debian/python-pysam-tests.README.Debian +++ /dev/null @@ -1,11 +0,0 @@ -Pysam for Debian -================ - -To verify whether your python-pysam modules are working correctly -you can run the test suite manually via - - cd /var/lib/pysam/tests - ./pysam_test.py - - -- Andreas Tille Fri, 07 Feb 2014 18:29:40 +0100 - diff --git a/debian/python-pysam-tests.install b/debian/python-pysam-tests.install deleted file mode 100644 index 5717f36..0000000 --- a/debian/python-pysam-tests.install +++ /dev/null @@ -1 +0,0 @@ -tests var/lib/pysam diff --git a/debian/python-pysam-tests.postinst b/debian/python-pysam-tests.postinst deleted file mode 100644 index b9d63dd..0000000 --- a/debian/python-pysam-tests.postinst +++ /dev/null @@ -1,20 +0,0 @@ -#!/bin/sh - -set -e - -case "$1" in - configure) - chmod a+w /var/lib/pysam/tests - chmod a+w /var/lib/pysam/tests/*.[bs]am* - ;; - - abort-upgrade|abort-remove|abort-deconfigure) - ;; - - *) - echo "postinst called with unknown argument \`$1'" >&2 - exit 1 - ;; -esac - -#DEBHELPER# diff --git a/debian/python-pysam-tests.prerm b/debian/python-pysam-tests.prerm deleted file mode 100644 index 6c79f5d..0000000 --- a/debian/python-pysam-tests.prerm +++ /dev/null @@ -1,22 +0,0 @@ -#!/bin/sh - -set -e - -case "$1" in - purge|remove|upgrade) - if [ -e /var/lib/pysam/tests/Makefile ] ; then - cd /var/lib/pysam/tests; make clean; rm -f log.txt - fi - ;; - failed-upgrade|abort-install|abort-upgrade|disappear) - ;; - - *) - echo "postrm called with unknown argument \`$1'" >&2 - exit 1 - ;; -esac - -#DEBHELPER# - -exit 0 diff --git a/debian/python-pysam.install b/debian/python-pysam.install deleted file mode 100644 index 13f83a7..0000000 --- a/debian/python-pysam.install +++ /dev/null @@ -1 +0,0 @@ -/usr/lib/python2.*/* diff --git a/debian/rules b/debian/rules deleted file mode 100755 index 8dbc39a..0000000 --- a/debian/rules +++ /dev/null @@ -1,55 +0,0 @@ -#!/usr/bin/make -f - -# Hint: -# https://wiki.debian.org/Python/LibraryStyleGuide -# suggests: -export PYBUILD_NAME=pysam -# which probably does not harm but due to the fact that there is -# some additional binary package a debian/python-pysam.install -# file is definitely needed. - -DEBPKGNAME := python-$(shell dpkg-parsechangelog | awk '/^Source:/ {print $$2}') -TESTPKG := $(DEBPKGNAME)-tests -pybuilddir := $(CURDIR)/build/lib.$(shell dpkg-architecture -qDEB_BUILD_ARCH_OS)-$(shell dpkg-architecture -qDEB_BUILD_GNU_CPU) - -%: - dh $@ --with python2 - -# Cython is recreating some c-files. To enable building twice in a row these -# will be saved in advance and restored afterwards -debian/savefiles: - mkdir -p debian/savefiles - cp -a `grep -l "Generated by Cython" pysam/*.c` debian/savefiles - -override_dh_clean: - dh_clean - # restore cython generated files - if [ -d debian/savefiles ] ; then \ - mv debian/savefiles/* pysam ; \ - rm -rf debian/savefiles ; \ - fi - -override_dh_auto_build: debian/savefiles - dh_auto_build - -override_dh_auto_test: - dh_auto_test - chmod a+x tests/pysam_test_offline.py -ifeq (,$(filter nocheck,$(DEB_BUILD_OPTIONS))) - set -e -x;\ - for pyv in `pyversions -dv` ; do \ - cd tests && env PYTHONPATH=$(pybuilddir)-$${pyv} ./pysam_test_offline.py ; \ - done -endif - -override_dh_install-indep: - dh_install -p $(TESTPKG) - cd debian/$(TESTPKG)/var/lib/pysam/tests; \ - make clean; \ - rm -f log.txt ; \ - chmod a+x tabix_test.py - -override_dh_auto_clean: - dh_auto_clean - cd tests; make clean - rm -f tests/log.txt diff --git a/debian/source/format b/debian/source/format deleted file mode 100644 index 163aaf8..0000000 --- a/debian/source/format +++ /dev/null @@ -1 +0,0 @@ -3.0 (quilt) diff --git a/debian/tests/control b/debian/tests/control deleted file mode 100644 index 516915b..0000000 --- a/debian/tests/control +++ /dev/null @@ -1,3 +0,0 @@ -Tests: run-unit-test -Depends: @, python-pysam-tests -Restrictions: allow-stderr diff --git a/debian/tests/run-unit-test b/debian/tests/run-unit-test deleted file mode 100644 index ffba74b..0000000 --- a/debian/tests/run-unit-test +++ /dev/null @@ -1,4 +0,0 @@ -#!/bin/sh -e - -cd /var/lib/pysam/tests -./pysam_test_offline.py diff --git a/debian/watch b/debian/watch deleted file mode 100644 index 1030de6..0000000 --- a/debian/watch +++ /dev/null @@ -1,4 +0,0 @@ -version=3 - -opts=downloadurlmangle=s|//code.google.com|| \ - http://code.google.com/p/pysam/downloads/list //pysam.googlecode.com/files/pysam-(.*).tar.gz